![]() |
OT: is this real?
|
Re: OT: is this real?
I don't know. I guess it could be real, but who would ever want to say it or write it? http://forum.shrapnelgames.com/images/icons/shock.gif
|
Re: OT: is this real?
That is wrong. The longest word is the full extension of DNA, which is either around 40,000 letters or 400,000 letters, I forget.
|
Re: OT: is this real?
|
Re: OT: is this real?
Quote:
|
Re: OT: is this real?
Check TerranC's link. http://forum.shrapnelgames.com/images/icons/icon12.gif I was way off on the number of letters.
|
Re: OT: is this real?
I think the Guiness people and whoever made the page Narf posted need to look up the definition of word. I don't think DNA or the word Narf posted qualify.
|
Re: OT: is this real?
What aspects of being a word do they not qualify for? They are properly constructed strings of letters that have a real, functional meaning.
[ December 24, 2003, 16:23: Message edited by: Imperator Fyron ] |
Re: OT: is this real?
DNA might qualify as a word since almost no one uses deoxyribonucleic acid, the long form. But the actual DNA sequences doesn't; its a code, not a word.
|
Re: OT: is this real?
Quote:
I don't think these 'words' have ever been used in speech or writing to communicate a meaning. But hey I could be wrong. There might actually be someone in the world who could say one of those words and use it in speech. And heck maybe somone could listen to it and get the meaning of it. http://forum.shrapnelgames.com/images/icons/tongue.gif http://forum.shrapnelgames.com/images/icons/icon7.gif [ December 24, 2003, 16:44: Message edited by: DavidG ] |
Re: OT: is this real?
Those long words have been used in written form before. Look at the website. http://forum.shrapnelgames.com/images/icons/icon12.gif And they most assuredly symbolize a meaning. There is no way you can dispute that part, at least. http://forum.shrapnelgames.com/images/icons/icon12.gif
|
Re: OT: is this real?
Quote:
meaningful unit of language sounds: a meaningful sound or combination of sounds that is a unit of language or its representation in a text. |
Re: OT: is this real?
Which again is what those words are. They are quite meaningful units of language sounds.
|
Re: OT: is this real?
Would you consider "tetrachloride" a word?
|
Re: OT: is this real?
Quote:
now, if you limited the arguement to words in common usage... |
Re: OT: is this real?
Quote:
</font><hr /></blockquote><font size="2" face="sans-serif, arial, verdana">I dispute the fact that these words 'communicate a meaning' You think a single person in the world can read or hear those words and get the specific meaning from them? and before anyone mentions it I think it is pretty clear that 'communicate a meaning' means to another human being. (else you could write the word out in binary and call it a long word) intersting side note. The Guiness people also have a record for the longest 'real' word. (thus of course implying that they don't think DNA is a real word) |
Re: OT: is this real?
Lets try this again. Is tetrachloride a "word"?
|
Re: OT: is this real?
I consider "tetrachloride" to be a word. I do NOT consider the chemical representation of tetrachloride, "Cl4", to be a word. Thus, I do not consider ACGTTACGG to be a word, even though it does convey meaning.
I am hard pressed to come up with a strict definition, but it would probably involve being a component of language which can be used to construct a sentence or phrase. the simple ability to convey meaning is too broad, and my definition above is too poor. someone else will have to do better, but i think my first paragraph sums up the opinion of those arguing against Fyron. |
Re: OT: is this real?
Considering the translation of the bases of DNA as a word is too much of a stretch on the definition for me. I'm not saying that things that might not be able to be communicated to another human being only verbally (ie, narf's original link) wouldn't be considered words. The sheer number of prefixes would prevent someone from being able to understand it completely just from the sound. However, it is properly constructed with English syllables, and it can be understood as an *English* word by stepping through it slowly.
DNA, however, simply consists of a long code of four letters, each one of which stands for a single word in itself. So the 'word' GGTGACTACGGTTTACAAAC is not a 20-character word, but rather a representation of a string of 20 words: Guanine Guanine Thymine Guanine Adenine Cytosine Thymine Adenine Cytosine Guanine Guanine Thymine Thymine Thymine Adenine Cytosine Adenine Adenine Adenine Cytosine So, in short, the 'name for human mitochondrial DNA' is not 207,000+ letters, but 207,000+ WORDS. Oh, and I can think of a very long word, if the only requirement is to convey meaning to another human being. I can remove all the non-letter characters from my keyboard, and pound on it for a few days. The resulting word should be able to convey the concept 'nonsense' to any human who reads it http://forum.shrapnelgames.com/images/icons/icon10.gif http://forum.shrapnelgames.com/images/icons/tongue.gif |
Re: OT: is this real?
Quote:
|
Re: OT: is this real?
I never said that GTTACA was a word... quite the contrary. That is not what they are talking about when they mention the full length word for DNA. That is NOT any particular DNA strand. http://forum.shrapnelgames.com/images/icons/icon12.gif
And even if you do not like DNA, the word mentioned at the beginning of this thread must be a word if tetrachloride is a word, because they are exactly the same thing, the word-representation of a chemical. They convey exactly as much meaning as "dog," "mouse," "puke," etc. convey, that of a noun. |
Re: OT: is this real?
besides, many words are made up of other words.
|
Re: OT: is this real?
i never claimed the word originating this thread was unwordly. just dna code and symbolic formulae.
|
Re: OT: is this real?
DNA code and symbolic forumlae are certainly not words... the fully extended name of DNA is though. It is not a symbolic formula, nor code of any sort.
|
Re: OT: is this real?
Hey Fyron... "The fully extended name of DNA" is deoxyribonucleic acid. Two words http://forum.shrapnelgames.com/images/icons/icon10.gif
I think you're saying what the link posted previously was saying, that the specific DNA spoken of is human mitochondrial DNA, and it's fully extended "name" is the longest word of English. Correct me if I'm wrong in that assumption, and disregard the rest of this posting if the assumption is wrong. I'm still not convinced however, that this is a true word, and not the coded sequence of a specific strand of human mitochondrial DNA. The main reasons are 1) nobody has produced the actual word, only a reference to it and it's approximate length, and 2) the approximate length, IIRC, would coincide with the number of base pairs in human mitochondrial DNA. I can't really think of any other way that a DNA strand would be referred to with a string of such length. |
Re: OT: is this real?
You guys still arguing about this?
The first posted 'word' is not a real word for the simple reason that it has never been spoken. Most definations of a word have one thing in common. that it is a unit of speech or the written representation of that. 'Speech' being the key word here. Since I assume this 'word' has never ever been spoken it is not a word. (and even if someone did attempt to speak this word I serious doubt it would convey any meaning in spoken form) |
Re: OT: is this real?
Quote:
|
Re: OT: is this real?
Words do not have to be spoken to be words. Written/typed words still count as words. And, that word most certainly conveys meaning. It conveys the same sort of meaning that "tetrachloride" conveys.
|
Re: OT: is this real?
They can come up with words as long as they want. They could synthesize bigger and bigger protein molecules or nucleic acid molecules, and I don't think there's a limit to how big a polymer that can be created.
|
Re: OT: is this real?
I can think of a way to further obfuscate this issue, but I think maybe I'm just going to leave it alone...aside from this #$R%%7! post.
|
Re: OT: is this real?
Quote:
Quote:
|
Re: OT: is this real?
on another note isn't it pretty much accepted that real names are not considerd words? Isn't the name of a chemical or protein really a real name? I mean I can call my kid ASDFASDFGASDFSDAFASDFASFAHOEL and that would be a string of letters with a meaning but it sure ain't a word.
|
Re: OT: is this real?
Quote:
I'm pretty sure all the names of compounds are words. If something like 'methanal' is a word, why not 'methylaminoethane'? If you follow that rule, then that longass name in the first post is also a word. |
Re: OT: is this real?
Quote:
Defining "word" as "an ordered collection of letters which conveys meaning" (or some such) does have problems, though. First, where's the differentiation between ordinary words and abbreviations/acronyms? Both FBI and UNSCOM are ordered collections of letters and both have meaning; but neither are words in the sense that "Fyron" or "alien" are. One could argue that words are valid only as representation of thoughts. A counter-argument could be that many Languages are capable of representing the concept of a pencil, but with obviously different words. The counter to that, then, would be that speech is a higher-level thought process than visualizing/conceptualizing, and that words, being a proprietary subset of speech, are also more complex than the concepts conveyed by them. Or something like that. http://forum.shrapnelgames.com/images/icons/icon7.gif My oversimplified summation of the argument is this: 1) No one denies that collections of letters not traditionally defined as words can have meaning; 2) Conservative linguists would not typically define FBI or UNSCOM or a fully-expanded DNA code as words; 3) Deconstructivist linguists would probably define FBI and UNSCOM as words, given that they occur commonly enough to convey meaning to an intended target audience (effective communication of meaning determines status), while the DNA example would probably not be considered a word, as it is unlikely to be used effectively in communication; 4) A few would define nearly any meaningful combination of letters as a word, based upon its potential to convey meaning. The linguistic conservative in me wants to say word != meaning. The social conservative in me wants to say redefinition as word = meaning is part of the quest of the deviant linguists to be granted normalcy. http://forum.shrapnelgames.com/images/icons/icon10.gif The paranoid and conspiracy nut in my household just noticed that it has the fingerprints of the Trilateral Commission and the CFR all over it. I can't say any more now, since they're listening--I'll contact you in the usual way later. [ December 29, 2003, 04:18: Message edited by: Krsqk ] |
Re: OT: is this real?
If you guys will recall back to grammar school, "doghouse" and "paperclip" are both compound words. Thus, something like "tetrameythlmonocarbide" is a compound word, compounding tetra, meythl, mono, and carbide. (which i probably spelled wrong or used the incorrect termonology for. ah well. i cant even promise that those chemicals actually sucessfully combine into a molecule.)
GTTCAG is not, nor is FBI, as they abbreviate chains of seperate words, and not a single compound word. you could argue that you are only counting distinct words with their own meanings, but many words have entimology derived from one or multiple other root words, or different prefixes and suffixes. this is where the definition might get a bit sticky. anyway, this thread is possibly the most ridiculous excuse for an arguement that I have ever seen. moderate me down for participating in it. |
Re: OT: is this real?
Quote:
|
Re: OT: is this real?
Here's a long word for you:
polemicalfyronoracularatory 27 letters. It's an adjective. http://forum.shrapnelgames.com/images/icons/icon12.gif [ December 29, 2003, 20:05: Message edited by: geoschmo ] |
Re: OT: is this real?
LOL. So you would use that word in a sentence such as:
You started another polemicalfyronoracularatory thread on philosophy! http://forum.shrapnelgames.com/images/icons/icon12.gif |
Re: OT: is this real?
how about: 'what does polemicalfyronoracularatory mean?'
|
Re: OT: is this real?
...
|
Re: OT: is this real?
polemical: what?
fyron: yep, know what that means... oracularatory: above's habit of making pronouncements, probably. there. now you have a breakdown. |
Re: OT: is this real?
Quote:
|
Re: OT: is this real?
I agree with Puke... out with the acronyms!!! http://forum.shrapnelgames.com/images/icons/icon10.gif
(you guys should be politicians) [ December 30, 2003, 13:39: Message edited by: Cipher7071 ] |
Re: OT: is this real?
i say we form the FAAA! http://forum.shrapnelgames.com/images/icons/icon10.gif
[ December 30, 2003, 18:56: Message edited by: narf poit chez BOOM ] |
Re: OT: is this real?
What's an FAAA?
|
Re: OT: is this real?
Forumers Against All Acronyms! http://forum.shrapnelgames.com/images/icons/icon10.gif
|
Re: OT: is this real?
Quote:
|
Re: OT: is this real?
Faaa is actually the town on Tahiti where their international airport is. Pronounced Fah-ah-ah.
|
| All times are GMT -4. The time now is 01:45 PM. |
Powered by vBulletin® Version 3.8.1
Copyright ©2000 - 2025, Jelsoft Enterprises Ltd.
Copyright ©1999 - 2025, Shrapnel Games, Inc. - All Rights Reserved.