View Single Post
  #5  
Old December 26th, 2003, 08:45 AM
Will's Avatar

Will Will is offline
Lieutenant Colonel
 
Join Date: Mar 2001
Location: Emeryville, CA
Posts: 1,412
Thanks: 0
Thanked 0 Times in 0 Posts
Will is on a distinguished road
Default Re: OT: is this real?

Considering the translation of the bases of DNA as a word is too much of a stretch on the definition for me. I'm not saying that things that might not be able to be communicated to another human being only verbally (ie, narf's original link) wouldn't be considered words. The sheer number of prefixes would prevent someone from being able to understand it completely just from the sound. However, it is properly constructed with English syllables, and it can be understood as an *English* word by stepping through it slowly.

DNA, however, simply consists of a long code of four letters, each one of which stands for a single word in itself. So the 'word' GGTGACTACGGTTTACAAAC is not a 20-character word, but rather a representation of a string of 20 words:
Guanine Guanine Thymine Guanine Adenine Cytosine Thymine Adenine Cytosine Guanine Guanine Thymine Thymine Thymine Adenine Cytosine Adenine Adenine Adenine Cytosine
So, in short, the 'name for human mitochondrial DNA' is not 207,000+ letters, but 207,000+ WORDS.

Oh, and I can think of a very long word, if the only requirement is to convey meaning to another human being. I can remove all the non-letter characters from my keyboard, and pound on it for a few days. The resulting word should be able to convey the concept 'nonsense' to any human who reads it
__________________
GEEK CODE V.3.12: GCS/E d-- s: a-- C++ US+ P+ L++ E--- W+++ N+ !o? K- w-- !O M++ V? PS+ PE Y+ PGP t- 5++ X R !tv-- b+++ DI++ D+ G+ e+++ h !r*-- y?
SE4 CODE: A-- Se+++* GdY $?/++ Fr! C++* Css Sf Ai Au- M+ MpN S Ss- RV Pw- Fq-- Nd Rp+ G- Mm++ Bb@ Tcp- L+
Reply With Quote